Transcript: Human NM_019849.3

Homo sapiens solute carrier family 7 member 10 (SLC7A10), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SLC7A10 (56301)
Length:
1946
CDS:
148..1719

Additional Resources:

NCBI RefSeq record:
NM_019849.3
NBCI Gene record:
SLC7A10 (56301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436989 CAACCTTCGGAGGGATCAATG pLKO_005 1121 CDS 100% 10.800 15.120 N SLC7A10 n/a
2 TRCN0000437983 CGGCGTCATCATCATCCTTAC pLKO_005 1500 CDS 100% 6.000 4.200 N SLC7A10 n/a
3 TRCN0000043234 CACCATCATCATCGGGAACAT pLKO.1 285 CDS 100% 4.950 3.465 N SLC7A10 n/a
4 TRCN0000043236 CGTGTACACGTTCACCAACAT pLKO.1 981 CDS 100% 4.950 3.465 N SLC7A10 n/a
5 TRCN0000043233 CAGCTTCATCTCAGAGCCTAT pLKO.1 1467 CDS 100% 4.050 2.835 N SLC7A10 n/a
6 TRCN0000043237 CAATGCCTTTGCTTTCTGGAT pLKO.1 807 CDS 100% 2.640 1.848 N SLC7A10 n/a
7 TRCN0000043235 GCTCATCAACTATGTGTCCTT pLKO.1 1305 CDS 100% 2.640 1.848 N SLC7A10 n/a
8 TRCN0000219416 AGATCTTCCAAGGACACTTTG pLKO.1 770 CDS 100% 10.800 7.560 N Slc7a10 n/a
9 TRCN0000219410 CCATGACCTTCTCCAACTATG pLKO.1 563 CDS 100% 10.800 7.560 N Slc7a10 n/a
10 TRCN0000219413 TCATCATCGGGAACATCATTG pLKO.1 290 CDS 100% 10.800 7.560 N Slc7a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03719 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03719 pLX_304 0% 100% 100% V5 n/a
Download CSV