Transcript: Mouse NM_019959.3

Mus musculus C1q and tumor necrosis factor related protein 1 (C1qtnf1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
C1qtnf1 (56745)
Length:
4383
CDS:
107..952

Additional Resources:

NCBI RefSeq record:
NM_019959.3
NBCI Gene record:
C1qtnf1 (56745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127124 GCAAATATCATGGGTTTCTTA pLKO.1 1356 3UTR 100% 5.625 3.938 N C1qtnf1 n/a
2 TRCN0000127127 GAACCTCTACAAACACTTCAA pLKO.1 622 CDS 100% 4.950 3.465 N C1qtnf1 n/a
3 TRCN0000127125 GCACACCTGTATACCAGACAA pLKO.1 345 CDS 100% 4.950 3.465 N C1qtnf1 n/a
4 TRCN0000127128 CACGGAGTTTGTGAACCTCTA pLKO.1 610 CDS 100% 4.050 2.835 N C1qtnf1 n/a
5 TRCN0000127126 CTTCAATATGTTCACTGGGAA pLKO.1 637 CDS 100% 2.640 1.848 N C1qtnf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.