Transcript: Mouse NM_020030.2

Mus musculus retinoic acid early transcript delta (Raet1d), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Raet1d (56554)
Length:
1287
CDS:
135..884

Additional Resources:

NCBI RefSeq record:
NM_020030.2
NBCI Gene record:
Raet1d (56554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339787 ATGATTCAGAAGCTGTTAATT pLKO_005 171 CDS 100% 15.000 7.500 Y Raet1a n/a
2 TRCN0000339856 CACAGTAAGCTTCACAATAAA pLKO_005 1094 3UTR 100% 15.000 7.500 Y Raet1a n/a
3 TRCN0000339785 TTACAAGTCACCATGATTTAT pLKO_005 486 CDS 100% 15.000 7.500 Y Raet1a n/a
4 TRCN0000077046 ACCAATGGTTACCCACATTTA pLKO.1 468 CDS 100% 13.200 6.600 Y Raet1c n/a
5 TRCN0000339788 ACTTCTAAGAAAGGATTTATC pLKO_005 810 CDS 100% 13.200 6.600 Y Raet1a n/a
6 TRCN0000112614 GACCAATGGTTACCCACATTT pLKO.1 467 CDS 100% 13.200 6.600 Y Raet1b n/a
7 TRCN0000339789 TCCTCCATTTAAGTAACATAA pLKO_005 310 CDS 100% 13.200 6.600 Y Raet1a n/a
8 TRCN0000375007 TCTCCCTCCTCTAATACATTT pLKO_005 1025 3UTR 100% 13.200 6.600 Y Raet1e n/a
9 TRCN0000375006 TCCAATACTGGGAACTGAATC pLKO_005 958 3UTR 100% 10.800 5.400 Y Raet1e n/a
10 TRCN0000112572 CCAGTATCACCCAGCTTACAT pLKO.1 757 CDS 100% 5.625 2.813 Y Raet1e n/a
11 TRCN0000077043 CCCTCCTCTAATACATTTCTT pLKO.1 1028 3UTR 100% 5.625 2.813 Y Raet1c n/a
12 TRCN0000112525 CCTCCTCTAATACATTTCTTA pLKO.1 1029 3UTR 100% 5.625 2.813 Y Raet1a n/a
13 TRCN0000112587 TGGGACTCATCTTCATATCTT pLKO.1 835 CDS 100% 5.625 2.813 Y Raet1d n/a
14 TRCN0000112574 ACACTCTCTTAGGTGCAACTT pLKO.1 230 CDS 100% 4.950 2.475 Y Raet1e n/a
15 TRCN0000112528 CCAGCCACTCTACTTCTAAGA pLKO.1 799 CDS 100% 4.950 2.475 Y Raet1a n/a
16 TRCN0000112526 GAAAGATTTGTGCCAGAAGTT pLKO.1 407 CDS 100% 4.950 2.475 Y Raet1a n/a
17 TRCN0000112588 GTGGACACTCACAAGACCAAT pLKO.1 453 CDS 100% 4.950 2.475 Y Raet1d n/a
18 TRCN0000112586 TCACCCAGCTTACATCAACTT pLKO.1 763 CDS 100% 4.950 2.475 Y Raet1d n/a
19 TRCN0000112610 GCTCTTTGCTACTGAGCCTTA pLKO.1 1004 3UTR 100% 4.050 2.025 Y Raet1b n/a
20 TRCN0000077045 CCCACATTTACAAGTCACCAT pLKO.1 479 CDS 100% 2.640 1.320 Y Raet1c n/a
21 TRCN0000077047 TGACAGTTACTTCTTCACCTT pLKO.1 557 CDS 100% 2.640 1.320 Y Raet1c n/a
22 TRCN0000112589 AGCTGGAGATCAGCTAATGAT pLKO.1 594 CDS 100% 0.563 0.281 Y Raet1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.