Transcript: Human NM_020406.4

Homo sapiens CD177 molecule (CD177), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CD177 (57126)
Length:
2195
CDS:
30..1343

Additional Resources:

NCBI RefSeq record:
NM_020406.4
NBCI Gene record:
CD177 (57126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161360 GTTGAACCACACCAGACAAAT pLKO.1 1169 CDS 100% 13.200 18.480 N CD177 n/a
2 TRCN0000371750 TGATTGGACCACATCGAATAC pLKO_005 713 CDS 100% 10.800 15.120 N CD177 n/a
3 TRCN0000162108 CCATTATGACACACGGAAACT pLKO.1 676 CDS 100% 4.950 6.930 N CD177 n/a
4 TRCN0000371702 GCCCTTCCTGCTAACTCTATT pLKO_005 1330 CDS 100% 13.200 9.240 N CD177 n/a
5 TRCN0000371751 GTGCTCCAGCCAAACGTATTT pLKO_005 1762 3UTR 100% 13.200 9.240 N CD177 n/a
6 TRCN0000163954 CAGGACACGTTGATGCTCATT pLKO.1 195 CDS 100% 4.950 3.465 N CD177 n/a
7 TRCN0000164430 CCAGTCTGCTTGTCTATGGAA pLKO.1 429 CDS 100% 3.000 2.100 N CD177 n/a
8 TRCN0000163311 GCTCAATGGGACACAGGAAAT pLKO.1 590 CDS 100% 10.800 6.480 N CD177 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08705 pDONR223 100% 99.6% 98.8% None (many diffs) n/a
2 ccsbBroad304_08705 pLX_304 0% 99.6% 98.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV