Transcript: Mouse NM_020506.1

Mus musculus exportin 4 (Xpo4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Xpo4 (57258)
Length:
3456
CDS:
1..3456

Additional Resources:

NCBI RefSeq record:
NM_020506.1
NBCI Gene record:
Xpo4 (57258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164776 CTCCGCTAATACCTCCAGAAA pLKO.1 1673 CDS 100% 4.950 6.930 N XPO4 n/a
2 TRCN0000105649 GCTATGTTTGAATCCTCACAA pLKO.1 745 CDS 100% 4.950 6.930 N Xpo4 n/a
3 TRCN0000324117 GCTATGTTTGAATCCTCACAA pLKO_005 745 CDS 100% 4.950 6.930 N Xpo4 n/a
4 TRCN0000105645 GCTACCTCTTAGCTGATGATA pLKO.1 1640 CDS 100% 5.625 4.500 N Xpo4 n/a
5 TRCN0000324181 GCTACCTCTTAGCTGATGATA pLKO_005 1640 CDS 100% 5.625 4.500 N Xpo4 n/a
6 TRCN0000105648 GCGTTGGAAGAAGTGCTTGAT pLKO.1 1159 CDS 100% 4.950 3.960 N Xpo4 n/a
7 TRCN0000324183 GCGTTGGAAGAAGTGCTTGAT pLKO_005 1159 CDS 100% 4.950 3.960 N Xpo4 n/a
8 TRCN0000105647 CCGCTAATACCTCCAGAAATA pLKO.1 1675 CDS 100% 13.200 9.240 N Xpo4 n/a
9 TRCN0000324184 CCGCTAATACCTCCAGAAATA pLKO_005 1675 CDS 100% 13.200 9.240 N Xpo4 n/a
10 TRCN0000105646 GCATTGGTTTAATGGAAGTTT pLKO.1 2513 CDS 100% 5.625 3.938 N Xpo4 n/a
11 TRCN0000324182 GCATTGGTTTAATGGAAGTTT pLKO_005 2513 CDS 100% 5.625 3.938 N Xpo4 n/a
12 TRCN0000370130 GCCGAAGCCCACCTCTTAATT pLKO_005 2204 CDS 100% 15.000 12.000 N XPO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.