Transcript: Mouse NM_020560.2

Mus musculus mitochondrial ribosomal protein S31 (Mrps31), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mrps31 (57312)
Length:
1536
CDS:
127..1281

Additional Resources:

NCBI RefSeq record:
NM_020560.2
NBCI Gene record:
Mrps31 (57312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126262 GCTGGACATTATTAAGGACAT pLKO.1 390 CDS 100% 4.050 3.240 N Mrps31 n/a
2 TRCN0000351844 GCTGGACATTATTAAGGACAT pLKO_005 390 CDS 100% 4.050 3.240 N Mrps31 n/a
3 TRCN0000126259 CCGAATTCCATGAGCATATAT pLKO.1 1070 CDS 100% 0.000 0.000 N Mrps31 n/a
4 TRCN0000126260 GCACTAGCAGATCAATCTGTA pLKO.1 275 CDS 100% 4.950 3.465 N Mrps31 n/a
5 TRCN0000351843 GCACTAGCAGATCAATCTGTA pLKO_005 275 CDS 100% 4.950 3.465 N Mrps31 n/a
6 TRCN0000126263 CAGTTCTCTTAAGCAGGAGAA pLKO.1 792 CDS 100% 0.405 0.284 N Mrps31 n/a
7 TRCN0000351845 CAGTTCTCTTAAGCAGGAGAA pLKO_005 792 CDS 100% 0.405 0.284 N Mrps31 n/a
8 TRCN0000126261 GCTCCGAATTCCATGAGCATA pLKO.1 1067 CDS 100% 0.000 0.000 N Mrps31 n/a
9 TRCN0000351846 GCTCCGAATTCCATGAGCATA pLKO_005 1067 CDS 100% 0.000 0.000 N Mrps31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.