Transcript: Human NM_020638.3

Homo sapiens fibroblast growth factor 23 (FGF23), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
FGF23 (8074)
Length:
3002
CDS:
131..886

Additional Resources:

NCBI RefSeq record:
NM_020638.3
NBCI Gene record:
FGF23 (8074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058767 ACACTATTTCGACCCGGAGAA pLKO.1 445 CDS 100% 4.050 5.670 N FGF23 n/a
2 TRCN0000058764 GATGCTGGCTTTGTGGTGATT pLKO.1 365 CDS 100% 4.950 3.960 N FGF23 n/a
3 TRCN0000372257 CCGCCTTCCTCACTCCATATA pLKO_005 1077 3UTR 100% 13.200 9.240 N FGF23 n/a
4 TRCN0000372258 GGGTCTCTCCCAACATATTTC pLKO_005 1168 3UTR 100% 13.200 9.240 N FGF23 n/a
5 TRCN0000058765 CCACTCTCCTCAGTATCACTT pLKO.1 511 CDS 100% 4.950 3.465 N FGF23 n/a
6 TRCN0000058763 CTGCATGGATTTCAGAGGCAA pLKO.1 412 CDS 100% 2.640 1.848 N FGF23 n/a
7 TRCN0000058766 CGCCGAGGACAACAGCCCGAT pLKO.1 766 CDS 100% 0.000 0.000 N FGF23 n/a
8 TRCN0000372259 TCCTCAGAGCCTATCCCAATG pLKO_005 192 CDS 100% 6.000 3.600 N FGF23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.