Transcript: Human NM_020705.3

Homo sapiens TBC1 domain family member 24 (TBC1D24), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
TBC1D24 (57465)
Length:
6593
CDS:
160..1821

Additional Resources:

NCBI RefSeq record:
NM_020705.3
NBCI Gene record:
TBC1D24 (57465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245854 GGAGTGAGAGAAATAAGTTTG pLKO_005 1376 CDS 100% 10.800 8.640 N TBC1D24 n/a
2 TRCN0000245855 ATTGCTGCTGGGTCATGATTT pLKO_005 4043 3UTR 100% 13.200 9.240 N TBC1D24 n/a
3 TRCN0000245857 AGGATGTCCTGCAGGTCTATG pLKO_005 767 CDS 100% 10.800 7.560 N TBC1D24 n/a
4 TRCN0000257752 CTTCTTTGGGACCGGAGAATG pLKO_005 1410 CDS 100% 10.800 7.560 N TBC1D24 n/a
5 TRCN0000245856 TGCAGATGGCCAATGAGAAAG pLKO_005 1067 CDS 100% 10.800 6.480 N TBC1D24 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4680 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4680 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.