Transcript: Human NM_020748.4

Homo sapiens integrator complex subunit 2 (INTS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
INTS2 (57508)
Length:
5847
CDS:
43..3657

Additional Resources:

NCBI RefSeq record:
NM_020748.4
NBCI Gene record:
INTS2 (57508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020748.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415016 CTATGGGTAATGACGGTTAAT pLKO_005 2524 CDS 100% 13.200 18.480 N INTS2 n/a
2 TRCN0000422655 TACTTACTCCTGCGTCGAAAT pLKO_005 1850 CDS 100% 10.800 15.120 N INTS2 n/a
3 TRCN0000416542 ACACATGTAAGAAACTCATTA pLKO_005 3911 3UTR 100% 13.200 10.560 N INTS2 n/a
4 TRCN0000418059 GGATATCTTCTTGCATCTAAA pLKO_005 2689 CDS 100% 13.200 10.560 N INTS2 n/a
5 TRCN0000168361 GCCTTCCCAGAATAATACAAT pLKO.1 2751 CDS 100% 5.625 4.500 N INTS2 n/a
6 TRCN0000167136 CCAATTATTACACGTCTTCAA pLKO.1 3475 CDS 100% 4.950 3.960 N INTS2 n/a
7 TRCN0000168179 CCCAACATGAATCTGCATATT pLKO.1 3698 3UTR 100% 13.200 9.240 N INTS2 n/a
8 TRCN0000257665 TTGACATTGGATCATACTAAA pLKO_005 883 CDS 100% 13.200 9.240 N Ints2 n/a
9 TRCN0000168795 GCTCCTGACTAATAATGCTAA pLKO.1 2271 CDS 100% 4.950 3.465 N INTS2 n/a
10 TRCN0000416280 GAACAGCAGCTTAGGCATAAA pLKO_005 346 CDS 100% 13.200 7.920 N INTS2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5089 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5089 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020748.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.