Transcript: Human NM_020774.3

Homo sapiens mindbomb E3 ubiquitin protein ligase 1 (MIB1), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
MIB1 (57534)
Length:
9567
CDS:
256..3276

Additional Resources:

NCBI RefSeq record:
NM_020774.3
NBCI Gene record:
MIB1 (57534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004557 GCCGAGTACAACAGATTTATT pLKO.1 1364 CDS 100% 15.000 21.000 N MIB1 n/a
2 TRCN0000342502 GCCGAGTACAACAGATTTATT pLKO_005 1364 CDS 100% 15.000 21.000 N MIB1 n/a
3 TRCN0000004556 CAAGGATAATACCAATGTCAA pLKO.1 3066 CDS 100% 4.950 6.930 N MIB1 n/a
4 TRCN0000342504 CAAGGATAATACCAATGTCAA pLKO_005 3066 CDS 100% 4.950 6.930 N MIB1 n/a
5 TRCN0000004555 GCAATAAGTAAGAAACGTGAT pLKO.1 1963 CDS 100% 4.050 5.670 N MIB1 n/a
6 TRCN0000004553 CAGAGGATAAAGATGGTGATA pLKO.1 1730 CDS 100% 4.950 3.465 N MIB1 n/a
7 TRCN0000342503 CAGAGGATAAAGATGGTGATA pLKO_005 1730 CDS 100% 4.950 3.465 N MIB1 n/a
8 TRCN0000004554 CCTCTGGGATAATGGTGCTAA pLKO.1 840 CDS 100% 4.950 3.465 N MIB1 n/a
9 TRCN0000352693 CCTCTGGGATAATGGTGCTAA pLKO_005 840 CDS 100% 4.950 3.465 N MIB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.