Transcript: Human NM_020795.4

Homo sapiens neuroligin 2 (NLGN2), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
NLGN2 (57555)
Length:
4980
CDS:
412..2919

Additional Resources:

NCBI RefSeq record:
NM_020795.4
NBCI Gene record:
NLGN2 (57555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075279 CCCGAGCGTATCACCATCTTT pLKO.1 1177 CDS 100% 5.625 7.875 N NLGN2 n/a
2 TRCN0000075281 CCTCAACTACGACATGCTCAT pLKO.1 1530 CDS 100% 4.050 5.670 N NLGN2 n/a
3 TRCN0000075278 CCAGCAGGAATAATTTGAAAT pLKO.1 4411 3UTR 100% 13.200 9.240 N NLGN2 n/a
4 TRCN0000075280 GAGAAGCAGTATCTGCACATA pLKO.1 2140 CDS 100% 4.950 3.465 N NLGN2 n/a
5 TRCN0000075282 GCTTCGGGAGACCATCAAGTT pLKO.1 1689 CDS 100% 4.950 3.465 N NLGN2 n/a
6 TRCN0000184441 GCAGTATCTGCACATAGGCTT pLKO.1 2145 CDS 100% 2.640 1.848 N Nlgn2 n/a
7 TRCN0000328638 GCAGTATCTGCACATAGGCTT pLKO_005 2145 CDS 100% 2.640 1.848 N Nlgn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.