Transcript: Human NM_020827.3

Homo sapiens cilia and flagella associated protein 97 (CFAP97), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CFAP97 (57587)
Length:
4851
CDS:
120..1718

Additional Resources:

NCBI RefSeq record:
NM_020827.3
NBCI Gene record:
CFAP97 (57587)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268639 GTCCGTACAGCTTGGTTATAA pLKO_005 1698 CDS 100% 15.000 21.000 N CFAP97 n/a
2 TRCN0000268678 ATCCACTCTTGGCCAATATAG pLKO_005 1562 CDS 100% 13.200 18.480 N CFAP97 n/a
3 TRCN0000268677 ATGGACTATCATCGCAATATG pLKO_005 1503 CDS 100% 13.200 18.480 N CFAP97 n/a
4 TRCN0000268680 TCGTGCATATTCCTATAATTC pLKO_005 1767 3UTR 100% 13.200 18.480 N CFAP97 n/a
5 TRCN0000268679 TCCGCTAAACCATCTACTAAC pLKO_005 570 CDS 100% 10.800 15.120 N CFAP97 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12370 pDONR223 100% 83.4% 82.4% None (many diffs) n/a
2 ccsbBroad304_12370 pLX_304 0% 83.4% 82.4% V5 (many diffs) n/a
3 TRCN0000491464 CGAGTGGTTGACCCCTTCCATATA pLX_317 29.7% 83.4% 82.4% V5 (many diffs) n/a
Download CSV