Transcript: Human NM_020870.4

Homo sapiens SH3 domain containing ring finger 1 (SH3RF1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SH3RF1 (57630)
Length:
5120
CDS:
194..2860

Additional Resources:

NCBI RefSeq record:
NM_020870.4
NBCI Gene record:
SH3RF1 (57630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417780 GGATCGTAGGTTCTCGAAATG pLKO_005 309 CDS 100% 10.800 15.120 N SH3RF1 n/a
2 TRCN0000412759 TAGTCTGGATTCGGATGTATA pLKO_005 3050 3UTR 100% 13.200 10.560 N SH3RF1 n/a
3 TRCN0000073063 CCAGTGTGTATGTTGCTATAT pLKO.1 1533 CDS 100% 13.200 9.240 N SH3RF1 n/a
4 TRCN0000423532 TGTTTACAAGGCTTAACTAAT pLKO_005 3150 3UTR 100% 13.200 9.240 N SH3RF1 n/a
5 TRCN0000222572 CCCACCAACTTTGTGCAGATT pLKO.1 743 CDS 100% 4.950 3.465 N SH3RF1 n/a
6 TRCN0000073066 CCTCGGAAAGAGGATGAACTA pLKO.1 1565 CDS 100% 4.950 3.465 N SH3RF1 n/a
7 TRCN0000073067 TGTGGCTAATTGTAGCTCAAA pLKO.1 502 CDS 100% 4.950 3.465 N SH3RF1 n/a
8 TRCN0000073064 GCAGAACTTGAACTTAAAGAA pLKO.1 2729 CDS 100% 5.625 3.375 N SH3RF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020870.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.