Transcript: Human NM_020889.3

Homo sapiens PHD finger protein 12 (PHF12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PHF12 (57649)
Length:
2985
CDS:
559..2673

Additional Resources:

NCBI RefSeq record:
NM_020889.3
NBCI Gene record:
PHF12 (57649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230208 TGCGCTCCAGTGCAGCATATT pLKO_005 1869 CDS 100% 13.200 18.480 N PHF12 n/a
2 TRCN0000422162 TGCGCTCCAGTGCAGCATATT pLKO_005 1869 CDS 100% 13.200 18.480 N Phf12 n/a
3 TRCN0000230207 TTTCGCAGCATGTCGTCAAAG pLKO_005 1592 CDS 100% 10.800 15.120 N PHF12 n/a
4 TRCN0000218527 GAAGGTTCCTGATGCTATAAA pLKO_005 1689 CDS 100% 15.000 10.500 N PHF12 n/a
5 TRCN0000416950 GAAGGTTCCTGATGCTATAAA pLKO_005 1689 CDS 100% 15.000 10.500 N Phf12 n/a
6 TRCN0000230209 TGTTAACTTGTCCCGTTTATA pLKO_005 2806 3UTR 100% 15.000 10.500 N PHF12 n/a
7 TRCN0000015703 GCTGATATTAAGCCTGTTATT pLKO.1 1948 CDS 100% 13.200 9.240 N PHF12 n/a
8 TRCN0000234397 TCGTTCCCTTACCCGTCAAAG pLKO_005 1355 CDS 100% 10.800 7.560 N PHF12 n/a
9 TRCN0000015704 CCTCTCATCCAGTGTGACTAT pLKO.1 1411 CDS 100% 4.950 3.465 N PHF12 n/a
10 TRCN0000084422 CCTGAACCGAATCCACAAGAA pLKO.1 1620 CDS 100% 4.950 3.465 N Phf12 n/a
11 TRCN0000015705 CGAAAGAAACGAGAGCAGAAA pLKO.1 874 CDS 100% 4.950 3.465 N PHF12 n/a
12 TRCN0000015707 CCTCTCCTGTTTCACATGGAT pLKO.1 1435 CDS 100% 3.000 2.100 N PHF12 n/a
13 TRCN0000423891 AGACAGAGAAGGCTGATATTA pLKO_005 1937 CDS 100% 15.000 9.000 N Phf12 n/a
14 TRCN0000015706 CATCGAGAACACCAGCACTTT pLKO.1 2460 CDS 100% 4.950 2.970 N PHF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.