Transcript: Human NM_021141.4

Homo sapiens X-ray repair cross complementing 5 (XRCC5), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
XRCC5 (7520)
Length:
3379
CDS:
90..2288

Additional Resources:

NCBI RefSeq record:
NM_021141.4
NBCI Gene record:
XRCC5 (7520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021141.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221595 CCTCATATCAAGCATAACTAT pLKO.1 1317 CDS 100% 5.625 7.875 N XRCC5 n/a
2 TRCN0000288700 CCTCATATCAAGCATAACTAT pLKO_005 1317 CDS 100% 5.625 7.875 N XRCC5 n/a
3 TRCN0000039842 CGTGGGCTTTACCATGAGTAA pLKO.1 134 CDS 100% 4.950 6.930 N XRCC5 n/a
4 TRCN0000288701 CGTGGGCTTTACCATGAGTAA pLKO_005 134 CDS 100% 4.950 6.930 N XRCC5 n/a
5 TRCN0000010468 AATCTAAGAGAGCTGCCATCG pLKO.1 2306 3UTR 100% 0.000 0.000 N XRCC5 n/a
6 TRCN0000307986 AATCTAAGAGAGCTGCCATCG pLKO_005 2306 3UTR 100% 0.000 0.000 N XRCC5 n/a
7 TRCN0000221592 GCAGCCCTTGTGATGTGATTA pLKO.1 2627 3UTR 100% 13.200 9.240 N XRCC5 n/a
8 TRCN0000018363 AGAGGAAGCCTCTGGAAGTTC pLKO.1 2153 CDS 100% 4.950 3.465 N XRCC5 n/a
9 TRCN0000295856 AGAGGAAGCCTCTGGAAGTTC pLKO_005 2153 CDS 100% 4.950 3.465 N XRCC5 n/a
10 TRCN0000221593 CGCTTTAACAACTTCCTGAAA pLKO.1 2049 CDS 100% 4.950 3.465 N XRCC5 n/a
11 TRCN0000010467 TGAAGATGGACCTACAGCTAA pLKO.1 1763 CDS 100% 4.950 3.465 N XRCC5 n/a
12 TRCN0000221594 CCTGCAATTCTTCTTGCCTTT pLKO.1 569 CDS 100% 4.050 2.835 N XRCC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021141.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.