Transcript: Human NM_021184.4

Homo sapiens chromosome 6 open reading frame 47 (C6orf47), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
C6orf47 (57827)
Length:
2481
CDS:
832..1716

Additional Resources:

NCBI RefSeq record:
NM_021184.4
NBCI Gene record:
C6orf47 (57827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263646 GAAACCTGGTAGGCGTGAGAA pLKO_005 1269 CDS 100% 4.950 6.930 N C6orf47 n/a
2 TRCN0000263644 GCTGTTCTGAGCCTACTTACT pLKO_005 1531 CDS 100% 4.950 6.930 N C6orf47 n/a
3 TRCN0000263645 AGTATGATGGTGGTGAATAAA pLKO_005 2010 3UTR 100% 15.000 12.000 N C6orf47 n/a
4 TRCN0000282735 CAAACTCAGATGGGATCATGT pLKO_005 1170 CDS 100% 4.950 3.465 N C6orf47 n/a
5 TRCN0000263643 GCCTATCTCTAGCACTCAAGA pLKO_005 1116 CDS 100% 4.950 3.465 N C6orf47 n/a
6 TRCN0000172758 CAGCCTATCTCTAGCACTCAA pLKO.1 1114 CDS 100% 4.950 2.970 N C6orf47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.