Transcript: Human NM_021189.5

Homo sapiens cell adhesion molecule 3 (CADM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CADM3 (57863)
Length:
3841
CDS:
152..1450

Additional Resources:

NCBI RefSeq record:
NM_021189.5
NBCI Gene record:
CADM3 (57863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021189.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057090 CACTACTTGATCCGGCACAAA pLKO.1 1310 CDS 100% 4.950 6.930 N CADM3 n/a
2 TRCN0000057091 CGCATACAGGAAGATCCCAAT pLKO.1 785 CDS 100% 4.050 3.240 N CADM3 n/a
3 TRCN0000412468 GACGACAAGAAGGAATATTTC pLKO_005 1424 CDS 100% 13.200 9.240 N CADM3 n/a
4 TRCN0000433658 GTGAACCATGAATCTCTAAAG pLKO_005 884 CDS 100% 10.800 7.560 N CADM3 n/a
5 TRCN0000057092 CGAGTACACCTGCTCAATCTT pLKO.1 571 CDS 100% 5.625 3.938 N CADM3 n/a
6 TRCN0000057088 CCACCCTAAACTGTCAGTCTT pLKO.1 696 CDS 100% 4.950 3.465 N CADM3 n/a
7 TRCN0000057089 GCCCTTCGAGATAATCGAATT pLKO.1 482 CDS 100% 0.000 0.000 N CADM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021189.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08772 pDONR223 100% 91.8% 91.8% None (many diffs) n/a
2 ccsbBroad304_08772 pLX_304 0% 91.8% 91.8% V5 (many diffs) n/a
Download CSV