Transcript: Human NM_021193.4

Homo sapiens homeobox D12 (HOXD12), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
HOXD12 (3238)
Length:
2549
CDS:
8..820

Additional Resources:

NCBI RefSeq record:
NM_021193.4
NBCI Gene record:
HOXD12 (3238)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021193.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421347 CCGAAGAGCAGGCTAAGTTCT pLKO_005 288 CDS 100% 4.950 6.930 N HOXD12 n/a
2 TRCN0000019794 GTCGCCAGACTCTTTCTACTT pLKO.1 64 CDS 100% 4.950 6.930 N HOXD12 n/a
3 TRCN0000019795 CCTCGTCAACGAATTCATCAA pLKO.1 670 CDS 100% 0.000 0.000 N HOXD12 n/a
4 TRCN0000019796 CCGCTCAACTTGAACATGACA pLKO.1 512 CDS 100% 3.000 2.400 N HOXD12 n/a
5 TRCN0000019797 GCTCTCAAAGCGGCCAAGTAT pLKO.1 398 CDS 100% 5.625 3.938 N HOXD12 n/a
6 TRCN0000429951 TTGCCTCTTGCCTGCGACCTT pLKO_005 549 CDS 100% 0.880 0.616 N HOXD12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021193.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10889 pDONR223 100% 74.9% 70.1% None (many diffs) n/a
2 ccsbBroad304_10889 pLX_304 0% 74.9% 70.1% V5 (many diffs) n/a
Download CSV