Transcript: Human NM_021213.4

Homo sapiens phosphatidylcholine transfer protein (PCTP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PCTP (58488)
Length:
1972
CDS:
54..698

Additional Resources:

NCBI RefSeq record:
NM_021213.4
NBCI Gene record:
PCTP (58488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021213.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180594 GATCCGGGTGAAGCAATACAA pLKO.1 500 CDS 100% 5.625 7.875 N PCTP n/a
2 TRCN0000180273 CCCATGTCCAACAGAGACTAT pLKO.1 375 CDS 100% 4.950 6.930 N PCTP n/a
3 TRCN0000425054 AGACTGGACTTTATGAGTATA pLKO_005 196 CDS 100% 13.200 9.240 N PCTP n/a
4 TRCN0000147488 GCCTTCTTCTACAGTTCAATA pLKO.1 951 3UTR 100% 13.200 9.240 N PCTP n/a
5 TRCN0000180102 CGCCAAGAATGGAGTTCCTAA pLKO.1 626 CDS 100% 4.950 3.465 N PCTP n/a
6 TRCN0000146425 CTGTCAGAACTACCTCAAGAA pLKO.1 671 CDS 100% 4.950 3.465 N PCTP n/a
7 TRCN0000148194 GACATCTATATGGACTCAGAT pLKO.1 261 CDS 100% 4.950 3.465 N PCTP n/a
8 TRCN0000105216 CTGGGAAGTGAAGTACCCTTT pLKO.1 353 CDS 100% 4.050 2.835 N Pctp n/a
9 TRCN0000427310 AGTATGTTAAAGAACTCTATG pLKO_005 301 CDS 100% 10.800 6.480 N PCTP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021213.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08777 pDONR223 100% 99.8% 100% None 483C>T n/a
Download CSV