Transcript: Mouse NM_021275.4

Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 4 (Kcna4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kcna4 (16492)
Length:
4844
CDS:
1263..3227

Additional Resources:

NCBI RefSeq record:
NM_021275.4
NBCI Gene record:
Kcna4 (16492)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021275.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069214 CCGGTGATTGTGTCTAACTTT pLKO.1 2934 CDS 100% 5.625 7.875 N Kcna4 n/a
2 TRCN0000069217 CAGGGATGATAGGGACCTTAT pLKO.1 2261 CDS 100% 10.800 7.560 N Kcna4 n/a
3 TRCN0000069216 CGCTTCGAAACCCAAATGAAA pLKO.1 1821 CDS 100% 5.625 3.938 N Kcna4 n/a
4 TRCN0000069213 CGTCTCATTTATTGTTCTCTT pLKO.1 4080 3UTR 100% 4.950 3.465 N Kcna4 n/a
5 TRCN0000069215 CCTACCTTCTAATTTGCTCAA pLKO.1 3029 CDS 100% 4.050 2.835 N Kcna4 n/a
6 TRCN0000044143 CGGGTGTCTTAACCATTGCTT pLKO.1 2905 CDS 100% 3.000 2.100 N KCNA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021275.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.