Transcript: Mouse NM_021286.4

Mus musculus seizure related gene 6 (Sez6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sez6 (20370)
Length:
4219
CDS:
222..3197

Additional Resources:

NCBI RefSeq record:
NM_021286.4
NBCI Gene record:
Sez6 (20370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101138 GCCCTTTGTCAAATACGGCAA pLKO.1 1814 CDS 100% 2.160 3.024 N Sez6 n/a
2 TRCN0000101136 GCATTTGACAATCCAACTTAT pLKO.1 3135 CDS 100% 13.200 9.240 N Sez6 n/a
3 TRCN0000416118 TATGAGCCCTTTGTCAAATAC pLKO_005 1809 CDS 100% 13.200 9.240 N SEZ6 n/a
4 TRCN0000101135 CCCTCTCTAAAGGCTCAGAAT pLKO.1 3695 3UTR 100% 4.950 3.465 N Sez6 n/a
5 TRCN0000101139 CTTTGTCAAATACGGCAACTT pLKO.1 1817 CDS 100% 4.950 3.465 N Sez6 n/a
6 TRCN0000101137 CCCAAGTGTCTCTTGGAACAA pLKO.1 2694 CDS 100% 0.495 0.347 N Sez6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.