Transcript: Mouse NM_021310.3

Mus musculus junction-mediating and regulatory protein (Jmy), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Jmy (57748)
Length:
8780
CDS:
503..3454

Additional Resources:

NCBI RefSeq record:
NM_021310.3
NBCI Gene record:
Jmy (57748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177467 GAGCCCATCATACAATACAAA pLKO.1 2421 CDS 100% 5.625 7.875 N Jmy n/a
2 TRCN0000350195 GAGCCCATCATACAATACAAA pLKO_005 2421 CDS 100% 5.625 7.875 N Jmy n/a
3 TRCN0000176531 CGAAGCTCTAAGAAGAATCAA pLKO.1 3370 CDS 100% 5.625 4.500 N Jmy n/a
4 TRCN0000319908 CGAAGCTCTAAGAAGAATCAA pLKO_005 3370 CDS 100% 5.625 4.500 N Jmy n/a
5 TRCN0000177116 GAGAGCATCAAGAGACTTATA pLKO.1 2144 CDS 100% 13.200 9.240 N Jmy n/a
6 TRCN0000319830 GAGAGCATCAAGAGACTTATA pLKO_005 2144 CDS 100% 13.200 9.240 N Jmy n/a
7 TRCN0000177280 GATTCCATTATGTCCTGAGTA pLKO.1 3547 3UTR 100% 4.950 3.465 N Jmy n/a
8 TRCN0000319839 GATTCCATTATGTCCTGAGTA pLKO_005 3547 3UTR 100% 4.950 3.465 N Jmy n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13178 pDONR223 100% 55.7% 56.9% None (many diffs) n/a
2 ccsbBroad304_13178 pLX_304 0% 55.7% 56.9% V5 (many diffs) n/a
Download CSV