Transcript: Mouse NM_021387.3

Mus musculus V-set and transmembrane domain containing 2B (Vstm2b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Vstm2b (58188)
Length:
1455
CDS:
91..948

Additional Resources:

NCBI RefSeq record:
NM_021387.3
NBCI Gene record:
Vstm2b (58188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021387.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336757 CCGGAGCAAGGTAACAAATAA pLKO_005 348 CDS 100% 15.000 21.000 N VSTM2B n/a
2 TRCN0000179678 GTTAGCACTACATAAGTTCCT pLKO.1 906 CDS 100% 2.640 3.696 N Vstm2b n/a
3 TRCN0000184000 CAAAGATGTAACCGTGCGAGA pLKO.1 192 CDS 100% 2.160 3.024 N Vstm2b n/a
4 TRCN0000184565 GCAAGTCCCTTGAGGATAGTA pLKO.1 1220 3UTR 100% 5.625 4.500 N Vstm2b n/a
5 TRCN0000180706 GCATGAAGAAGTCCATGCAAA pLKO.1 1016 3UTR 100% 0.495 0.347 N Vstm2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021387.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.