Transcript: Mouse NM_021390.3

Mus musculus sal-like 1 (Drosophila) (Sall1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Sall1 (58198)
Length:
5275
CDS:
151..4122

Additional Resources:

NCBI RefSeq record:
NM_021390.3
NBCI Gene record:
Sall1 (58198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257033 TTTGGCCTTGTAGGGTATATT pLKO_005 4891 3UTR 100% 15.000 21.000 N Sall1 n/a
2 TRCN0000238153 ATCCCGTCTCAAGGTACTTTA pLKO_005 958 CDS 100% 13.200 18.480 N Sall1 n/a
3 TRCN0000238155 TGGTCCTCCAGCAGCATATTC pLKO_005 2483 CDS 100% 13.200 18.480 N Sall1 n/a
4 TRCN0000238154 CCAAAGAGAGACCGTTCATTT pLKO_005 3218 CDS 100% 13.200 9.240 N Sall1 n/a
5 TRCN0000238156 CCTCACCAGCATTCGCAATAA pLKO_005 1274 CDS 100% 13.200 9.240 N Sall1 n/a
6 TRCN0000098340 CCACCAAATGTCACTGCCTTT pLKO.1 1441 CDS 100% 4.050 2.835 N Sall1 n/a
7 TRCN0000098343 GCACTATCTGTGGAAGAGCAT pLKO.1 3638 CDS 100% 2.640 1.848 N Sall1 n/a
8 TRCN0000098344 GCGCTGAATTCTTTGAATTAT pLKO.1 296 CDS 100% 0.000 0.000 N Sall1 n/a
9 TRCN0000098342 GCTGCGCTGAATTCTTTGAAT pLKO.1 293 CDS 100% 0.000 0.000 N Sall1 n/a
10 TRCN0000098341 CCCAAGATAGCCTGTCATCTT pLKO.1 2687 CDS 100% 0.495 0.297 N Sall1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.