Transcript: Mouse NM_021393.3

Mus musculus negative elongation factor complex member B (Nelfb), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nelfb (58202)
Length:
2650
CDS:
143..2029

Additional Resources:

NCBI RefSeq record:
NM_021393.3
NBCI Gene record:
Nelfb (58202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126521 CCAAGGTGCATGGGACTTAAT pLKO.1 1330 CDS 100% 13.200 9.240 N Nelfb n/a
2 TRCN0000126520 CCTGAGAGTTTCACCAAGTTT pLKO.1 1508 CDS 100% 5.625 3.938 N Nelfb n/a
3 TRCN0000309396 CCTGAGAGTTTCACCAAGTTT pLKO_005 1508 CDS 100% 5.625 3.938 N Nelfb n/a
4 TRCN0000126522 CCTGGACTTGTGGAAACGTTT pLKO.1 1622 CDS 100% 4.950 3.465 N Nelfb n/a
5 TRCN0000309286 CCTGGACTTGTGGAAACGTTT pLKO_005 1622 CDS 100% 4.950 3.465 N Nelfb n/a
6 TRCN0000126523 GAGGCAGATTTGGCAAGACAA pLKO.1 724 CDS 100% 4.950 3.465 N Nelfb n/a
7 TRCN0000331922 GAGGCAGATTTGGCAAGACAA pLKO_005 724 CDS 100% 4.950 3.465 N Nelfb n/a
8 TRCN0000126519 CCTGATATTCAATCTGCACAA pLKO.1 2306 3UTR 100% 4.050 2.835 N Nelfb n/a
9 TRCN0000309344 CCTGATATTCAATCTGCACAA pLKO_005 2306 3UTR 100% 4.050 2.835 N Nelfb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.