Transcript: Mouse NM_021433.3

Mus musculus syntaxin 6 (Stx6), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Stx6 (58244)
Length:
2459
CDS:
191..958

Additional Resources:

NCBI RefSeq record:
NM_021433.3
NBCI Gene record:
Stx6 (58244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339606 ATCACAAGTACTCGGCAAATT pLKO_005 464 CDS 100% 13.200 18.480 N Stx6 n/a
2 TRCN0000379491 GGCCGTCATGCTAGATGATTT pLKO_005 781 CDS 100% 13.200 18.480 N Stx6 n/a
3 TRCN0000115076 GCTGGGTAAGAGTTGAGATTA pLKO.1 1506 3UTR 100% 13.200 9.240 N Stx6 n/a
4 TRCN0000339680 GCTGGGTAAGAGTTGAGATTA pLKO_005 1506 3UTR 100% 13.200 9.240 N Stx6 n/a
5 TRCN0000379748 ACACTGCCCAAGGATTGTTTC pLKO_005 246 CDS 100% 10.800 7.560 N Stx6 n/a
6 TRCN0000115080 AGGAACAATCTCCGCAGCATA pLKO.1 341 CDS 100% 4.950 3.465 N Stx6 n/a
7 TRCN0000115079 CATCAGCATAGTTGAAGCAAA pLKO.1 391 CDS 100% 4.950 3.465 N Stx6 n/a
8 TRCN0000115078 CGTGATGAAGAAACTTGCAAA pLKO.1 841 CDS 100% 4.950 3.465 N Stx6 n/a
9 TRCN0000339605 CGTGATGAAGAAACTTGCAAA pLKO_005 841 CDS 100% 4.950 3.465 N Stx6 n/a
10 TRCN0000115077 CCATCAGCATAGTTGAAGCAA pLKO.1 390 CDS 100% 3.000 2.100 N Stx6 n/a
11 TRCN0000339679 CCATCAGCATAGTTGAAGCAA pLKO_005 390 CDS 100% 3.000 2.100 N Stx6 n/a
12 TRCN0000059464 GCATAGTTGAAGCAAATCCTA pLKO.1 396 CDS 100% 3.000 2.100 N STX6 n/a
13 TRCN0000291946 GCATAGTTGAAGCAAATCCTA pLKO_005 396 CDS 100% 3.000 2.100 N STX6 n/a
14 TRCN0000380713 GTGCCATAGCCATCCTCTTTG pLKO_005 897 CDS 100% 10.800 7.560 N STX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02362 pDONR223 100% 90.8% 94.5% None (many diffs) n/a
2 ccsbBroad304_02362 pLX_304 0% 90.8% 94.5% V5 (many diffs) n/a
Download CSV