Transcript: Mouse NM_021447.2

Mus musculus tripartite motif-containing 54 (Trim54), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Trim54 (58522)
Length:
1548
CDS:
299..1399

Additional Resources:

NCBI RefSeq record:
NM_021447.2
NBCI Gene record:
Trim54 (58522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177716 CAGACAGAAGCAACTGTTAAA pLKO.1 919 CDS 100% 13.200 9.240 N Trim54 n/a
2 TRCN0000181932 GCAGACAGAAGCAACTGTTAA pLKO.1 918 CDS 100% 13.200 9.240 N Trim54 n/a
3 TRCN0000200114 CGAGGACGAGAAGATCAACAT pLKO.1 685 CDS 100% 4.950 3.465 N Trim54 n/a
4 TRCN0000200146 CGCAGACAGAAGCAACTGTTA pLKO.1 917 CDS 100% 4.950 3.465 N Trim54 n/a
5 TRCN0000200389 GCTATGAGAGCATGGAGCAAT pLKO.1 1212 CDS 100% 4.950 3.465 N Trim54 n/a
6 TRCN0000033892 CACCATTTACAAACGCCAGAA pLKO.1 790 CDS 100% 4.050 2.835 N TRIM54 n/a
7 TRCN0000217139 CACCATTTACAAACGCCAGAA pLKO.1 790 CDS 100% 4.050 2.835 N Trim54 n/a
8 TRCN0000200198 CCTCTAATCCTCTGTGGCAAT pLKO.1 468 CDS 100% 4.050 2.835 N Trim54 n/a
9 TRCN0000200062 CAACTTGGAGAAGCAGCTCAT pLKO.1 352 CDS 100% 4.050 2.430 N Trim54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.