Transcript: Mouse NM_021506.2

Mus musculus SH3 domain containing ring finger 1 (Sh3rf1), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Sh3rf1 (59009)
Length:
5199
CDS:
271..2946

Additional Resources:

NCBI RefSeq record:
NM_021506.2
NBCI Gene record:
Sh3rf1 (59009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304949 TAAGCACCACTGGGTTAATTG pLKO_005 1346 CDS 100% 13.200 18.480 N Sh3rf1 n/a
2 TRCN0000112936 CCAATTTCATACGTGGAGTTT pLKO.1 1018 CDS 100% 4.950 6.930 N Sh3rf1 n/a
3 TRCN0000112935 CGTGTGACTAAAGAGCACAAA pLKO.1 2983 3UTR 100% 4.950 6.930 N Sh3rf1 n/a
4 TRCN0000302824 CGTGTGACTAAAGAGCACAAA pLKO_005 2983 3UTR 100% 4.950 6.930 N Sh3rf1 n/a
5 TRCN0000112939 CCGTGTGCCAAAGCATTATAT pLKO.1 679 CDS 100% 15.000 12.000 N Sh3rf1 n/a
6 TRCN0000302747 CCGTGTGCCAAAGCATTATAT pLKO_005 679 CDS 100% 15.000 12.000 N Sh3rf1 n/a
7 TRCN0000112938 CCAGTGTATATGTTGCTATAT pLKO.1 1628 CDS 100% 13.200 9.240 N Sh3rf1 n/a
8 TRCN0000423532 TGTTTACAAGGCTTAACTAAT pLKO_005 3241 3UTR 100% 13.200 9.240 N SH3RF1 n/a
9 TRCN0000304950 ACGAATGCCTCCCAAGCTAAA pLKO_005 1813 CDS 100% 10.800 7.560 N Sh3rf1 n/a
10 TRCN0000112937 GCCGAACTTGAACTCAAGGAA pLKO.1 2815 CDS 100% 3.000 2.100 N Sh3rf1 n/a
11 TRCN0000302825 GCCGAACTTGAACTCAAGGAA pLKO_005 2815 CDS 100% 3.000 2.100 N Sh3rf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.