Transcript: Mouse NM_021517.2

Mus musculus PDZ domain containing 1 (Pdzk1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pdzk1 (59020)
Length:
2435
CDS:
95..1654

Additional Resources:

NCBI RefSeq record:
NM_021517.2
NBCI Gene record:
Pdzk1 (59020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105374 GCTGATGATCACTTGATTGAA pLKO.1 620 CDS 100% 5.625 7.875 N Pdzk1 n/a
2 TRCN0000105371 GCCGCTCTGAATGATAAGAAA pLKO.1 428 CDS 100% 5.625 4.500 N Pdzk1 n/a
3 TRCN0000059671 GCCATGAGGAAGTGGTTGAAA pLKO.1 669 CDS 100% 5.625 3.938 N PDZK1 n/a
4 TRCN0000105373 TGTGGTGGAAATGATTAGAAA pLKO.1 1003 CDS 100% 5.625 3.938 N Pdzk1 n/a
5 TRCN0000105370 CCTGTTATAGAAGTGTGCTTT pLKO.1 1969 3UTR 100% 4.950 3.465 N Pdzk1 n/a
6 TRCN0000105372 GCCAAAGTCAAGAACTGCCTA pLKO.1 1110 CDS 100% 2.640 1.848 N Pdzk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.