Transcript: Human NM_021574.3

Homo sapiens BCR activator of RhoGEF and GTPase (BCR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BCR (613)
Length:
6651
CDS:
453..4136

Additional Resources:

NCBI RefSeq record:
NM_021574.3
NBCI Gene record:
BCR (613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148322 ATGAGGAGATCACACCCCGA pXPR_003 CGG 2082 57% 8 1.2114 BCR BCR 76908
2 BRDN0001148847 AACTCCGTAGTTGTCCACGA pXPR_003 AGG 1783 48% 5 0.7906 BCR BCR 76907
3 BRDN0001144903 TCCCCACAGAGGGCGAACAA pXPR_003 GGG 2414 66% 11 -0.0057 BCR BCR 76909
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199731 GCGAGGGTTCTCCGGGTAAGG pLKO.1 808 CDS 100% 0.000 0.000 N BCR n/a
2 TRCN0000195608 CTACGGAGTTGCCATGGAAAT pLKO.1 2243 CDS 100% 10.800 7.560 N BCR n/a
3 TRCN0000000793 AGAGCCAGAAGCAACAAAGAT pLKO.1 2319 CDS 100% 5.625 3.938 N BCR n/a
4 TRCN0000342375 AGAGCCAGAAGCAACAAAGAT pLKO_005 2319 CDS 100% 5.625 3.938 N BCR n/a
5 TRCN0000195722 CCCTCACTGTTGTATCTTGAA pLKO.1 4527 3UTR 100% 4.950 3.465 N BCR n/a
6 TRCN0000342378 CCCTCACTGTTGTATCTTGAA pLKO_005 4527 3UTR 100% 4.950 3.465 N BCR n/a
7 TRCN0000000790 CTGACCAACTCGTGTGTGAAA pLKO.1 3096 CDS 100% 4.950 3.465 N BCR n/a
8 TRCN0000342376 CTGACCAACTCGTGTGTGAAA pLKO_005 3096 CDS 100% 4.950 3.465 N BCR n/a
9 TRCN0000000792 GTTCCTGATCTCCTCTGACTA pLKO.1 2987 CDS 100% 4.950 3.465 N BCR n/a
10 TRCN0000000789 CAAGAGTTACACGTTCCTGAT pLKO.1 2975 CDS 100% 4.050 2.835 N BCR n/a
11 TRCN0000366057 TGGTGAAGGTCAACGACAAAG pLKO_005 1015 CDS 100% 10.800 6.480 N Bcr n/a
12 TRCN0000194953 CAGATCCAGATACCTAATAAG pLKO.1 5168 3UTR 100% 13.200 6.600 Y BCR n/a
13 TRCN0000147220 CCTAATAAGATGCTGGAATGT pLKO.1 5180 3UTR 100% 4.950 2.475 Y BCRP2 n/a
14 TRCN0000147268 GTGTGGATTTAGTTGTGCTTT pLKO.1 5883 3UTR 100% 4.950 2.475 Y BCRP2 n/a
15 TRCN0000082602 GCAGCATTTGGTCTTCCTCTA pLKO.1 5225 3UTR 100% 4.050 2.025 Y LOC440820 n/a
16 TRCN0000146832 CCAGATACCTAATAAGATGCT pLKO.1 5173 3UTR 100% 2.640 1.320 Y BCRP2 n/a
17 TRCN0000147269 GATACCTAATAAGATGCTGGA pLKO.1 5176 3UTR 100% 2.160 1.080 Y BCRP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021574.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.