Transcript: Mouse NM_021604.3

Mus musculus agrin (Agrn), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Agrn (11603)
Length:
7379
CDS:
69..6173

Additional Resources:

NCBI RefSeq record:
NM_021604.3
NBCI Gene record:
Agrn (11603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079980 GCTGCAATCATCAGGAGCAAA pLKO.1 5163 CDS 100% 4.950 3.960 N Agrn n/a
2 TRCN0000079978 GCACTGTTTGTGTGTTATTAA pLKO.1 6497 3UTR 100% 15.000 10.500 N Agrn n/a
3 TRCN0000326012 GCACTGTTTGTGTGTTATTAA pLKO_005 6497 3UTR 100% 15.000 10.500 N Agrn n/a
4 TRCN0000306144 CATGTCAGACCTGAATCATAT pLKO_005 1043 CDS 100% 13.200 9.240 N Agrn n/a
5 TRCN0000311465 CCAACCACTACCGCCAGTATT pLKO_005 3969 CDS 100% 13.200 9.240 N Agrn n/a
6 TRCN0000079981 GCTCAGATGCTTCCACCTATA pLKO.1 706 CDS 100% 10.800 7.560 N Agrn n/a
7 TRCN0000326013 GCTCAGATGCTTCCACCTATA pLKO_005 706 CDS 100% 10.800 7.560 N Agrn n/a
8 TRCN0000079982 GCTCAGATGGAGTCACCTATA pLKO.1 2230 CDS 100% 10.800 7.560 N Agrn n/a
9 TRCN0000079979 CCTGCCAGTTTAACTCTGTAT pLKO.1 1267 CDS 100% 4.950 3.465 N Agrn n/a
10 TRCN0000306206 CTGTCAGCAGCAGGTACAAAT pLKO_005 2021 CDS 100% 13.200 7.920 N Agrn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.