Transcript: Human NM_021785.5

Homo sapiens retinoic acid induced 2 (RAI2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RAI2 (10742)
Length:
2187
CDS:
226..1818

Additional Resources:

NCBI RefSeq record:
NM_021785.5
NBCI Gene record:
RAI2 (10742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021785.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139530 CCTGAGACACTGTATGACAGT pLKO.1 1294 CDS 100% 2.640 3.696 N RAI2 n/a
2 TRCN0000139927 GAGCTCAATCCGAATGGCAAT pLKO.1 532 CDS 100% 4.050 3.240 N RAI2 n/a
3 TRCN0000413054 TGCAGCTTTAATGGAATATTG pLKO_005 2054 3UTR 100% 13.200 9.240 N RAI2 n/a
4 TRCN0000441623 TTGCCTGTGCCAGTCCCTATT pLKO_005 943 CDS 100% 10.800 7.560 N RAI2 n/a
5 TRCN0000145309 CCGGAGCATAAAGTTAAAGAA pLKO.1 1725 CDS 100% 5.625 3.938 N RAI2 n/a
6 TRCN0000144177 CATATTCTGTGGCAAGATCAA pLKO.1 1572 CDS 100% 4.950 3.465 N RAI2 n/a
7 TRCN0000121887 GAGTAAATAAGAGCAACCTAT pLKO.1 2009 3UTR 100% 4.950 3.465 N RAI2 n/a
8 TRCN0000145332 GCTAATAACAGACTGGAGAAT pLKO.1 286 CDS 100% 4.950 3.465 N RAI2 n/a
9 TRCN0000142922 CCATGATGGATAGTCACATCA pLKO.1 1412 CDS 100% 0.495 0.347 N RAI2 n/a
10 TRCN0000217313 GAAGCTGTGCTCCAGAATTTA pLKO.1 778 CDS 100% 15.000 10.500 N Rai2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021785.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07673 pDONR223 100% 99.9% 99.8% None 1024G>C n/a
2 ccsbBroad304_07673 pLX_304 0% 99.9% 99.8% V5 1024G>C n/a
Download CSV