Transcript: Mouse NM_021886.2

Mus musculus centromere protein H (Cenph), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cenph (26886)
Length:
1251
CDS:
98..823

Additional Resources:

NCBI RefSeq record:
NM_021886.2
NBCI Gene record:
Cenph (26886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021886.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072102 TCGGGATAACATGGAGAACAT pLKO.1 415 CDS 100% 4.950 3.960 N Cenph n/a
2 TRCN0000351127 TCGGGATAACATGGAGAACAT pLKO_005 415 CDS 100% 4.950 3.960 N Cenph n/a
3 TRCN0000072101 CAGAACAGATTATGCAAGAAA pLKO.1 285 CDS 100% 5.625 3.938 N Cenph n/a
4 TRCN0000351126 CAGAACAGATTATGCAAGAAA pLKO_005 285 CDS 100% 5.625 3.938 N Cenph n/a
5 TRCN0000072100 CTACAGTTGTTCAACATACAT pLKO.1 705 CDS 100% 5.625 3.938 N Cenph n/a
6 TRCN0000351157 CTACAGTTGTTCAACATACAT pLKO_005 705 CDS 100% 5.625 3.938 N Cenph n/a
7 TRCN0000072099 GCTGCTTGATGTCAGAAAGAA pLKO.1 538 CDS 100% 5.625 3.938 N Cenph n/a
8 TRCN0000351128 GCTGCTTGATGTCAGAAAGAA pLKO_005 538 CDS 100% 5.625 3.938 N Cenph n/a
9 TRCN0000072098 GCTCTTAGAATATAAGTCCAT pLKO.1 238 CDS 100% 2.640 1.848 N Cenph n/a
10 TRCN0000331916 GCTCTTAGAATATAAGTCCAT pLKO_005 238 CDS 100% 2.640 1.848 N Cenph n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021886.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.