Transcript: Human NM_021912.5

Homo sapiens gamma-aminobutyric acid type A receptor beta3 subunit (GABRB3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GABRB3 (2562)
Length:
5702
CDS:
40..1461

Additional Resources:

NCBI RefSeq record:
NM_021912.5
NBCI Gene record:
GABRB3 (2562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021912.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061489 CGCTGGAAGTTCACAATGAAA pLKO.1 1151 CDS 100% 5.625 4.500 N GABRB3 n/a
2 TRCN0000299636 CGCTGGAAGTTCACAATGAAA pLKO_005 1151 CDS 100% 5.625 4.500 N GABRB3 n/a
3 TRCN0000061488 CCCTCTATACTGATAACGATT pLKO.1 796 CDS 100% 4.950 3.960 N GABRB3 n/a
4 TRCN0000299637 CCCTCTATACTGATAACGATT pLKO_005 796 CDS 100% 4.950 3.960 N GABRB3 n/a
5 TRCN0000061491 CCGTTCAAAGAGCGAAAGCAA pLKO.1 1095 CDS 100% 3.000 2.400 N GABRB3 n/a
6 TRCN0000310447 CCGTTCAAAGAGCGAAAGCAA pLKO_005 1095 CDS 100% 3.000 2.400 N GABRB3 n/a
7 TRCN0000061490 CCCGACACATATTTCTTAAAT pLKO.1 394 CDS 100% 15.000 10.500 N GABRB3 n/a
8 TRCN0000299568 CCCGACACATATTTCTTAAAT pLKO_005 394 CDS 100% 15.000 10.500 N GABRB3 n/a
9 TRCN0000061492 CAACTTAGTTTACTGGCTGTA pLKO.1 1428 CDS 100% 4.050 2.835 N GABRB3 n/a
10 TRCN0000299638 CAACTTAGTTTACTGGCTGTA pLKO_005 1428 CDS 100% 4.050 2.835 N GABRB3 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4040 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 4044 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021912.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.