Transcript: Human NM_021925.4

Homo sapiens lipid droplet associated hydrolase (LDAH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LDAH (60526)
Length:
3917
CDS:
68..1045

Additional Resources:

NCBI RefSeq record:
NM_021925.4
NBCI Gene record:
LDAH (60526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021925.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150271 GACAATCAAGTCCTTGCTAAT pLKO.1 676 CDS 100% 10.800 8.640 N LDAH n/a
2 TRCN0000129839 CCAGCCATTAAGTTATGTGAA pLKO.1 2107 3UTR 100% 4.950 3.960 N LDAH n/a
3 TRCN0000149527 GCTCCCAAAGACAAGAAGATT pLKO.1 329 CDS 100% 5.625 3.938 N LDAH n/a
4 TRCN0000130311 GAGGATTCAAACGCTCAAGAA pLKO.1 362 CDS 100% 4.950 3.465 N LDAH n/a
5 TRCN0000129885 GCCATACATTAACTCTCCATT pLKO.1 2034 3UTR 100% 4.950 3.465 N LDAH n/a
6 TRCN0000149469 GCCATGTTATAGGCTGAAGTA pLKO.1 1189 3UTR 100% 4.950 3.465 N LDAH n/a
7 TRCN0000148482 CCTAAAGGATGACTTGTCCAA pLKO.1 1018 CDS 100% 2.640 1.848 N LDAH n/a
8 TRCN0000127675 CCTCATGCTTTCATCACCCAT pLKO.1 962 CDS 100% 2.640 1.848 N LDAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021925.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08801 pDONR223 100% 99.8% 99.6% None 960T>A n/a
2 ccsbBroad304_08801 pLX_304 0% 99.8% 99.6% V5 960T>A n/a
Download CSV