Transcript: Human NM_021927.3

Homo sapiens GUF1 homolog, GTPase (GUF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GUF1 (60558)
Length:
4460
CDS:
204..2213

Additional Resources:

NCBI RefSeq record:
NM_021927.3
NBCI Gene record:
GUF1 (60558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423681 TCGTTGAAAGGGAGTAGTTAG pLKO_005 2331 3UTR 100% 10.800 15.120 N GUF1 n/a
2 TRCN0000139236 CCTCCTAAAGTGCATCGCAAA pLKO.1 936 CDS 100% 4.050 5.670 N GUF1 n/a
3 TRCN0000139986 GAACGGCTGAAGGATTCTCTT pLKO.1 1953 CDS 100% 4.950 3.960 N GUF1 n/a
4 TRCN0000140140 GCCTGGGTTTAAATCAGCGAA pLKO.1 1244 CDS 100% 2.640 2.112 N GUF1 n/a
5 TRCN0000435667 AGTGTTCTTCAGGCAATTATT pLKO_005 903 CDS 100% 15.000 10.500 N GUF1 n/a
6 TRCN0000436475 ATGTCACTGAAGCGCAAATAG pLKO_005 1183 CDS 100% 13.200 9.240 N GUF1 n/a
7 TRCN0000144754 GAAGAGCAGTTCAGAAGAATA pLKO.1 1687 CDS 100% 13.200 9.240 N GUF1 n/a
8 TRCN0000427819 GGTAGGCAAGAGCTTAGATTT pLKO_005 2354 3UTR 100% 13.200 9.240 N GUF1 n/a
9 TRCN0000141441 CTGATCCTGAAAGGGTTGAAA pLKO.1 805 CDS 100% 5.625 3.938 N GUF1 n/a
10 TRCN0000141051 CCTAGAACTTACAGGGACAAT pLKO.1 467 CDS 100% 4.950 3.465 N GUF1 n/a
11 TRCN0000141281 CCTAGGCAACTGTTTGAGATA pLKO.1 1974 CDS 100% 4.950 3.465 N GUF1 n/a
12 TRCN0000142244 GAGGAGCTAGTAACTGTTGTA pLKO.1 1893 CDS 100% 4.950 3.465 N GUF1 n/a
13 TRCN0000141467 CCTGGGTTTAAATCAGCGAAA pLKO.1 1245 CDS 100% 4.050 2.835 N GUF1 n/a
14 TRCN0000145002 GATAGCAATTCAAGCTGCTAT pLKO.1 1991 CDS 100% 0.495 0.347 N GUF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.