Transcript: Mouse NM_022000.3

Mus musculus GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gnas (14683)
Length:
2483
CDS:
260..1021

Additional Resources:

NCBI RefSeq record:
NM_022000.3
NBCI Gene record:
Gnas (14683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083413 GCTTGCTTAGATGTTCCAAAT pLKO.1 2264 3UTR 100% 10.800 15.120 N GNAS n/a
2 TRCN0000115056 CCTGCATGTTAATGGGTTTAA pLKO.1 1110 3UTR 100% 13.200 9.240 N Gnas n/a
3 TRCN0000320192 CCTGCATGTTAATGGGTTTAA pLKO_005 1110 3UTR 100% 13.200 9.240 N Gnas n/a
4 TRCN0000115060 TCGGGATGAGTTTCTGAGAAT pLKO.1 1947 3UTR 100% 4.950 3.465 N Gnas n/a
5 TRCN0000320131 TCGGGATGAGTTTCTGAGAAT pLKO_005 1947 3UTR 100% 4.950 3.465 N Gnas n/a
6 TRCN0000115059 GCCAAGTACTTCATTCGGGAT pLKO.1 1933 3UTR 100% 2.160 1.512 N Gnas n/a
7 TRCN0000320193 GCCAAGTACTTCATTCGGGAT pLKO_005 1933 3UTR 100% 2.160 1.512 N Gnas n/a
8 TRCN0000310794 ACCCACCATAGGGCATGATTA pLKO_005 2187 3UTR 100% 13.200 7.920 N GNAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.