Transcript: Human NM_022089.4

Homo sapiens ATPase cation transporting 13A2 (ATP13A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
ATP13A2 (23400)
Length:
3996
CDS:
191..3733

Additional Resources:

NCBI RefSeq record:
NM_022089.4
NBCI Gene record:
ATP13A2 (23400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425581 GGCCCACCTTTGGTATCATTG pLKO_005 2670 CDS 100% 10.800 15.120 N ATP13A2 n/a
2 TRCN0000050404 CCTGACGATAGGGACATCAAT pLKO.1 244 CDS 100% 5.625 7.875 N ATP13A2 n/a
3 TRCN0000050405 CCTGATCCTCTACACGATCAA pLKO.1 3034 CDS 100% 0.495 0.693 N ATP13A2 n/a
4 TRCN0000426610 TCGCTGTACAAGACCAGAAAG pLKO_005 1010 CDS 100% 10.800 8.640 N ATP13A2 n/a
5 TRCN0000050406 CGTTATCGAAATAAGAGACAA pLKO.1 454 CDS 100% 4.950 3.960 N ATP13A2 n/a
6 TRCN0000050407 GCCTCTGAATGAGATTGTAAT pLKO.1 1546 CDS 100% 13.200 9.240 N ATP13A2 n/a
7 TRCN0000423508 CTAAGGGACATGGTCAAGTTG pLKO_005 1043 CDS 100% 4.950 3.465 N ATP13A2 n/a
8 TRCN0000050403 GCCCATCAACTTCAAGTTCTA pLKO.1 1435 CDS 100% 4.950 3.465 N ATP13A2 n/a
9 TRCN0000101718 CACGCCGAAACACTCGTTATA pLKO.1 440 CDS 100% 13.200 18.480 N Atp13a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.