Transcript: Human NM_022336.4

Homo sapiens ectodysplasin A receptor (EDAR), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
EDAR (10913)
Length:
4062
CDS:
280..1626

Additional Resources:

NCBI RefSeq record:
NM_022336.4
NBCI Gene record:
EDAR (10913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022336.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358920 CAAGTCAGCCGGGATTCAAAG pLKO_005 1230 CDS 100% 10.800 15.120 N EDAR n/a
2 TRCN0000358854 GACTAGAGCCGGGATACTTTC pLKO_005 1809 3UTR 100% 10.800 15.120 N EDAR n/a
3 TRCN0000358921 TCAAGGAGCCAGACGAAATAA pLKO_005 1757 3UTR 100% 15.000 10.500 N EDAR n/a
4 TRCN0000358853 ACGATGCCTCATCCGAGAATG pLKO_005 1088 CDS 100% 10.800 7.560 N EDAR n/a
5 TRCN0000059233 CCTCATCATCATGTTCTACAT pLKO.1 888 CDS 100% 4.950 3.465 N EDAR n/a
6 TRCN0000059236 CGGTGAGAACGAGTACTACAA pLKO.1 372 CDS 100% 4.950 3.465 N EDAR n/a
7 TRCN0000059237 CGGGATTCAAAGCCGGAGGAA pLKO.1 1239 CDS 100% 0.880 0.616 N EDAR n/a
8 TRCN0000059234 GCCATTTGATTGCCTCGAGAA pLKO.1 1323 CDS 100% 0.000 0.000 N EDAR n/a
9 TRCN0000059235 CGAGAAGGATGAATTTGAGAA pLKO.1 1029 CDS 100% 4.950 2.970 N EDAR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022336.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.