Transcript: Human NM_022659.4

Homo sapiens EBF transcription factor 2 (EBF2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EBF2 (64641)
Length:
5166
CDS:
555..2282

Additional Resources:

NCBI RefSeq record:
NM_022659.4
NBCI Gene record:
EBF2 (64641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022659.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016339 CCACGCCTCAACAGTCTAATT pLKO.1 1948 CDS 100% 13.200 18.480 N EBF2 n/a
2 TRCN0000016698 TGACGCACGAAGTGATGTGTA pLKO.1 1015 CDS 100% 4.950 6.930 N EBF2 n/a
3 TRCN0000016701 CGGACCCAGTCATAATTGACA pLKO.1 1084 CDS 100% 3.000 4.200 N EBF2 n/a
4 TRCN0000016702 GCTCATCGACTCGGTCACCAA pLKO.1 938 CDS 100% 0.880 1.232 N EBF2 n/a
5 TRCN0000016340 CGGCTCTCCTTATGGAATCAT pLKO.1 2066 CDS 100% 5.625 4.500 N EBF2 n/a
6 TRCN0000016342 GCGTGGTAGAGGTGACATTAT pLKO.1 1489 CDS 100% 13.200 9.240 N EBF2 n/a
7 TRCN0000016341 GCTTGTATGGAGCGAGCTAAT pLKO.1 1421 CDS 100% 10.800 7.560 N EBF2 n/a
8 TRCN0000016699 AGGCAACGAGAAGACCAACAA pLKO.1 848 CDS 100% 4.950 3.465 N EBF2 n/a
9 TRCN0000016338 GCATTAAATGAACCCACCATA pLKO.1 1563 CDS 100% 4.950 3.465 N EBF2 n/a
10 TRCN0000016700 GAGGACCAACTCTGAAAGAGA pLKO.1 583 CDS 100% 3.000 2.100 N EBF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022659.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.