Transcript: Human NM_022726.4

Homo sapiens ELOVL fatty acid elongase 4 (ELOVL4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ELOVL4 (6785)
Length:
3013
CDS:
275..1219

Additional Resources:

NCBI RefSeq record:
NM_022726.4
NBCI Gene record:
ELOVL4 (6785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022726.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426603 ATCATCACTGTACGATGTTTA pLKO_005 753 CDS 100% 13.200 18.480 N ELOVL4 n/a
2 TRCN0000415066 CGATCACAGAAACGGTCTTTA pLKO_005 1568 3UTR 100% 13.200 18.480 N ELOVL4 n/a
3 TRCN0000221158 GATCATATAATGCGGGATATA pLKO.1 573 CDS 100% 13.200 18.480 N ELOVL4 n/a
4 TRCN0000221160 CGTCTAGTGCTCATTATCTAT pLKO.1 500 CDS 100% 5.625 7.875 N ELOVL4 n/a
5 TRCN0000221157 GCCTATGCAATCAGCTTCATA pLKO.1 1031 CDS 100% 5.625 7.875 N ELOVL4 n/a
6 TRCN0000416947 TCCAGACCAAAGCAATCATTA pLKO_005 1447 3UTR 100% 13.200 10.560 N ELOVL4 n/a
7 TRCN0000424998 AGACTGAGTAAAGTGTTAATA pLKO_005 1356 3UTR 100% 15.000 10.500 N ELOVL4 n/a
8 TRCN0000221159 CCTGACTATGTTGCAACTGAT pLKO.1 925 CDS 100% 4.950 3.465 N ELOVL4 n/a
9 TRCN0000221156 GCAAAGGGATTACTAGAGAAA pLKO.1 2626 3UTR 100% 4.950 3.465 N ELOVL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022726.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.