Transcript: Human NM_022778.5

Homo sapiens centrosomal protein 85 (CEP85), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CEP85 (64793)
Length:
3937
CDS:
134..2422

Additional Resources:

NCBI RefSeq record:
NM_022778.5
NBCI Gene record:
CEP85 (64793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022778.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134211 CGAGGAAGTTTGATATTCCTA pLKO.1 660 CDS 100% 0.300 0.420 N CEP85 n/a
2 TRCN0000134763 GCTTAAGGATTCTGAGTTGAA pLKO.1 1627 CDS 100% 4.950 3.960 N CEP85 n/a
3 TRCN0000229267 AGGGTCAAAGGTCGTGATAAA pLKO_005 1472 CDS 100% 13.200 9.240 N CEP85 n/a
4 TRCN0000250448 AGGGTCAAAGGTCGTGATAAA pLKO_005 1472 CDS 100% 13.200 9.240 N Cep85 n/a
5 TRCN0000218245 GCAATGATGGAGACACTTTAT pLKO_005 707 CDS 100% 13.200 9.240 N CEP85 n/a
6 TRCN0000229268 GTCGTGACATTGAGGACTTAA pLKO_005 2343 CDS 100% 13.200 9.240 N CEP85 n/a
7 TRCN0000218312 AGCTGGAATTGATTCGTTTAC pLKO_005 999 CDS 100% 10.800 7.560 N CEP85 n/a
8 TRCN0000136937 CAGCACAAGTAAGGAGTTGTA pLKO.1 769 CDS 100% 4.950 3.465 N CEP85 n/a
9 TRCN0000134173 CCATGCCATTTAACAAGAGAT pLKO.1 3048 3UTR 100% 4.950 3.465 N CEP85 n/a
10 TRCN0000136625 GCAGCTGGAATTGATTCGTTT pLKO.1 997 CDS 100% 4.950 3.465 N CEP85 n/a
11 TRCN0000138342 CCACCTTTCTTCTCCATCCAA pLKO.1 2728 3UTR 100% 3.000 2.100 N CEP85 n/a
12 TRCN0000136640 GAGAAGGAGATTCAACTGGAA pLKO.1 1718 CDS 100% 2.640 1.848 N CEP85 n/a
13 TRCN0000137501 CCATGTGATGCCTTCTACTTT pLKO.1 409 CDS 100% 5.625 3.375 N CEP85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022778.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12495 pDONR223 100% 25.4% 25.4% None 1_1704del n/a
2 ccsbBroad304_12495 pLX_304 0% 25.4% 25.4% V5 1_1704del n/a
Download CSV