Transcript: Mouse NM_022811.3

Mus musculus polymerase (RNA) I polypeptide E (Polr1e), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Polr1e (64424)
Length:
3547
CDS:
64..1368

Additional Resources:

NCBI RefSeq record:
NM_022811.3
NBCI Gene record:
Polr1e (64424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304796 ATCACTTCGTATGCGATTATA pLKO_005 1114 CDS 100% 15.000 21.000 N Polr1e n/a
2 TRCN0000099213 CCGGAAGACGTGTATAGATTT pLKO.1 736 CDS 100% 13.200 18.480 N Polr1e n/a
3 TRCN0000099212 CCCGCACATTATCAACACCAA pLKO.1 1014 CDS 100% 2.640 3.696 N Polr1e n/a
4 TRCN0000304797 GAGAGTATTATTGATACAAAG pLKO_005 625 CDS 100% 10.800 7.560 N Polr1e n/a
5 TRCN0000311140 TGTACAACAGCACCGACTTAG pLKO_005 236 CDS 100% 10.800 7.560 N Polr1e n/a
6 TRCN0000099214 GCTCTCCTATGTCGGAAACAA pLKO.1 306 CDS 100% 5.625 3.938 N Polr1e n/a
7 TRCN0000099210 CCACTTCTGTTCACTTCCATT pLKO.1 1382 3UTR 100% 4.950 3.465 N Polr1e n/a
8 TRCN0000316255 CCACTTCTGTTCACTTCCATT pLKO_005 1382 3UTR 100% 4.950 3.465 N Polr1e n/a
9 TRCN0000099211 GCCCTCAAATGCAATGCTCTT pLKO.1 340 CDS 100% 4.050 2.835 N Polr1e n/a
10 TRCN0000349033 CTGTTTGCTGACGATGCTATT pLKO_005 442 CDS 100% 10.800 6.480 N Polr1e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.