Transcript: Human NM_022909.4

Homo sapiens centromere protein H (CENPH), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CENPH (64946)
Length:
1354
CDS:
53..796

Additional Resources:

NCBI RefSeq record:
NM_022909.4
NBCI Gene record:
CENPH (64946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022909.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423741 TTTGTCTGTCCACCGTAATTT pLKO_005 866 3UTR 100% 15.000 21.000 N CENPH n/a
2 TRCN0000434696 GGATAAAGATCATACGACAAA pLKO_005 633 CDS 100% 4.950 6.930 N CENPH n/a
3 TRCN0000074138 GTTAGTTATTTGTAGTGGGAT pLKO.1 931 3UTR 100% 2.640 3.696 N CENPH n/a
4 TRCN0000412875 AGCATATCCATAACGTTTACA pLKO_005 893 3UTR 100% 5.625 4.500 N CENPH n/a
5 TRCN0000074142 GAGACTTTCAACTGCACTTAA pLKO.1 370 CDS 100% 13.200 9.240 N CENPH n/a
6 TRCN0000074139 CCAGAACAAATTATGCAAGAA pLKO.1 257 CDS 100% 4.950 3.465 N CENPH n/a
7 TRCN0000431180 GAAATCACAGCAGGAATCTTG pLKO_005 475 CDS 100% 4.950 3.465 N CENPH n/a
8 TRCN0000074141 GAAGATTGATTTGGACAGTAT pLKO.1 598 CDS 100% 4.950 3.465 N CENPH n/a
9 TRCN0000074140 GCTTGAGAAGAATGTTGACAT pLKO.1 769 CDS 100% 4.950 3.465 N CENPH n/a
10 TRCN0000431964 TGGCAATCTCAACTCTTATTT pLKO_005 829 3UTR 100% 15.000 9.000 N CENPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022909.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03987 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03987 pLX_304 0% 100% 100% V5 n/a
Download CSV