Transcript: Mouse NM_023063.4

Mus musculus LIM domain and actin binding 1 (Lima1), transcript variant b, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lima1 (65970)
Length:
4117
CDS:
507..2288

Additional Resources:

NCBI RefSeq record:
NM_023063.4
NBCI Gene record:
Lima1 (65970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023063.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426840 AGCCCAGCCAGCTACACAAAT pLKO_005 873 CDS 100% 13.200 18.480 N Lima1 n/a
2 TRCN0000112920 CCCATCATCAACAATAAGAAA pLKO.1 3138 3UTR 100% 5.625 7.875 N Lima1 n/a
3 TRCN0000420023 ATTCATGTGGGAGCAACTTTG pLKO_005 2383 3UTR 100% 10.800 7.560 N Lima1 n/a
4 TRCN0000445847 GAAGGGCTAAGTAGGGATTTC pLKO_005 2673 3UTR 100% 10.800 7.560 N Lima1 n/a
5 TRCN0000416294 TAAAGAGAAACCGGTACTATG pLKO_005 2245 CDS 100% 10.800 7.560 N Lima1 n/a
6 TRCN0000435305 GCAACTATGACGAGGGCTTTG pLKO_005 1369 CDS 100% 6.000 4.200 N Lima1 n/a
7 TRCN0000112922 CGACGATGGAAAGGAAACAAA pLKO.1 1909 CDS 100% 5.625 3.938 N Lima1 n/a
8 TRCN0000112921 GCCTCACTTCAATCAACTCTT pLKO.1 1337 CDS 100% 4.950 3.465 N Lima1 n/a
9 TRCN0000444400 TATCAAGTGGTGCGCAGAAAC pLKO_005 2340 3UTR 100% 10.800 6.480 N Lima1 n/a
10 TRCN0000112923 CCGGAAAGTTCTCCTTCCAAA pLKO.1 1131 CDS 100% 4.950 2.970 N Lima1 n/a
11 TRCN0000112924 CTGAAGATGATGTTTGAGAAA pLKO.1 615 CDS 100% 4.950 2.970 N Lima1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023063.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.