Transcript: Human NM_023068.4

Homo sapiens sialic acid binding Ig like lectin 1 (SIGLEC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SIGLEC1 (6614)
Length:
6960
CDS:
241..5370

Additional Resources:

NCBI RefSeq record:
NM_023068.4
NBCI Gene record:
SIGLEC1 (6614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023068.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153962 CAGTTCCATTAAGTGGCTCAA pLKO.1 1053 CDS 100% 4.050 5.670 N SIGLEC1 n/a
2 TRCN0000155147 GTGTGGAGATTCACAACCCTT pLKO.1 2258 CDS 100% 2.640 3.696 N SIGLEC1 n/a
3 TRCN0000420000 ACTTCTCCTGGTTCCGAAATG pLKO_005 2462 CDS 100% 10.800 8.640 N SIGLEC1 n/a
4 TRCN0000431725 GACTTCAACATGATAGAATTT pLKO_005 5804 3UTR 100% 13.200 9.240 N SIGLEC1 n/a
5 TRCN0000417948 GCTCTAACAAGAGACCAAATA pLKO_005 5779 3UTR 100% 13.200 9.240 N SIGLEC1 n/a
6 TRCN0000412901 ACATCTGTTCTGCCTCAAATG pLKO_005 5072 CDS 100% 10.800 7.560 N SIGLEC1 n/a
7 TRCN0000154843 GAGAACCAGACAGTGACACTA pLKO.1 1252 CDS 100% 4.950 3.465 N SIGLEC1 n/a
8 TRCN0000156121 CTTCGAGATCAGTGAGGTCAA pLKO.1 588 CDS 100% 4.050 2.835 N SIGLEC1 n/a
9 TRCN0000155705 CAACTCCACCTTTGCATGGTT pLKO.1 4665 CDS 100% 3.000 2.100 N SIGLEC1 n/a
10 TRCN0000154205 CAGGTGATGACACCTATGTTT pLKO.1 4493 CDS 100% 0.563 0.394 N SIGLEC1 n/a
11 TRCN0000155418 CAGAACTGATGCTGCCCTTTA pLKO.1 2535 CDS 100% 10.800 6.480 N SIGLEC1 n/a
12 TRCN0000152770 GCAGCCATAACTTTGACACAA pLKO.1 3082 CDS 100% 4.950 2.970 N SIGLEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023068.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.