Transcript: Mouse NM_023124.5

Mus musculus histocompatibility 2, Q region locus 8 (H2-Q8), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
H2-Q8 (15019)
Length:
1009
CDS:
29..1009

Additional Resources:

NCBI RefSeq record:
NM_023124.5
NBCI Gene record:
H2-Q8 (15019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023124.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066907 GAATTACACATGCCATGTGAA pLKO.1 856 CDS 100% 4.950 2.475 Y H2-Q6 n/a
2 TRCN0000066905 GACCGCACAGAGATACTACAA pLKO.1 328 CDS 100% 4.950 2.475 Y H2-Q6 n/a
3 TRCN0000066566 GCCCTGAACGAAGACCTGAAA pLKO.1 464 CDS 100% 4.950 2.475 Y H2-Q8 n/a
4 TRCN0000066906 GAGATACTACAACCAGAGCAA pLKO.1 337 CDS 100% 2.640 1.320 Y H2-Q6 n/a
5 TRCN0000066903 GAGCAGAATTACACATGCCAT pLKO.1 851 CDS 100% 2.640 1.320 Y H2-Q6 n/a
6 TRCN0000192133 GAGCAGAATTACACATGCCAT pLKO.1 851 CDS 100% 2.640 1.320 Y H2-D1 n/a
7 TRCN0000066904 CCGGTTCATTATCGTCGGCTA pLKO.1 151 CDS 100% 2.160 1.080 Y H2-Q6 n/a
8 TRCN0000066563 CCGCGATTACATCGCCCTGAA pLKO.1 451 CDS 100% 1.350 0.675 Y H2-Q8 n/a
9 TRCN0000066666 CCAGTGGATGTATGGCTGTAA pLKO.1 376 CDS 100% 4.950 2.475 Y H2-Q10 n/a
10 TRCN0000066567 GTGGATGTATGGCTGTGACAT pLKO.1 379 CDS 100% 4.950 2.475 Y H2-Q8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023124.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.