Transcript: Mouse NM_023184.3

Mus musculus Kruppel-like factor 15 (Klf15), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Klf15 (66277)
Length:
2294
CDS:
126..1373

Additional Resources:

NCBI RefSeq record:
NM_023184.3
NBCI Gene record:
Klf15 (66277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229892 CTACCCTGGAGGAGATTGAAG pLKO_005 538 CDS 100% 4.950 6.930 N KLF15 n/a
2 TRCN0000071471 GCGATCTCACTCGGGTGTGAA pLKO.1 1238 CDS 100% 1.650 2.310 N Klf15 n/a
3 TRCN0000071468 CCCTCAAAGTTTGTGCGAATT pLKO.1 945 CDS 100% 0.000 0.000 N Klf15 n/a
4 TRCN0000071470 ACCGAAATGCTCAGTGGGTTA pLKO.1 167 CDS 100% 4.050 3.240 N Klf15 n/a
5 TRCN0000071472 CATTTCTGCTTCCCTGAATTT pLKO.1 477 CDS 100% 13.200 9.240 N Klf15 n/a
6 TRCN0000071469 CCAAACCTATTGGCTCAGGAT pLKO.1 985 CDS 100% 2.640 1.584 N Klf15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08100 pDONR223 100% 83.3% 85% None (many diffs) n/a
2 ccsbBroad304_08100 pLX_304 0% 83.3% 85% V5 (many diffs) n/a
Download CSV