Transcript: Mouse NM_023190.3

Mus musculus apoptotic chromatin condensation inducer 1 (Acin1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Acin1 (56215)
Length:
4751
CDS:
152..4168

Additional Resources:

NCBI RefSeq record:
NM_023190.3
NBCI Gene record:
Acin1 (56215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238333 AGGATGAGACAGAGCGTAATG pLKO_005 2847 CDS 100% 10.800 15.120 N Acin1 n/a
2 TRCN0000238331 GATCGGCCATCTGAAACTAAG pLKO_005 3449 CDS 100% 10.800 15.120 N Acin1 n/a
3 TRCN0000123423 CAAGATCAAATCTCATTGCTT pLKO.1 3286 CDS 100% 3.000 2.400 N Acin1 n/a
4 TRCN0000359107 GGTCAGAGCAGATCGAAATTT pLKO_005 928 CDS 100% 15.000 10.500 N ACIN1 n/a
5 TRCN0000238334 ACCAGTGTCCCACGCTCATTT pLKO_005 4452 3UTR 100% 13.200 9.240 N Acin1 n/a
6 TRCN0000123421 CCTCTGACTGAGAGCCAAATT pLKO.1 3830 CDS 100% 13.200 9.240 N Acin1 n/a
7 TRCN0000238330 TAACATTAGGAGATACCTTAA pLKO_005 3060 CDS 100% 10.800 7.560 N Acin1 n/a
8 TRCN0000123420 GCCCAAGTCATTCAAGAGGAA pLKO.1 2599 CDS 100% 2.640 1.848 N Acin1 n/a
9 TRCN0000238332 AGGCCAGCTGAAGGAATTATT pLKO_005 3223 CDS 100% 15.000 9.000 N Acin1 n/a
10 TRCN0000123419 CCCTCTCCTTTCTTCCTGTTA pLKO.1 4375 3UTR 100% 4.950 2.970 N Acin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023190.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.