Transcript: Mouse NM_023210.4

Mus musculus acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (Anp32e), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Mus musculus (mouse)
Gene:
Anp32e (66471)
Length:
3273
CDS:
341..1123

Additional Resources:

NCBI RefSeq record:
NM_023210.4
NBCI Gene record:
Anp32e (66471)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023210.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312816 CAGAGTTAGTCCTCGATAATT pLKO_005 399 CDS 100% 15.000 21.000 N Anp32e n/a
2 TRCN0000077257 CCAAATCTTACCTACCTCAAT pLKO.1 602 CDS 100% 4.950 6.930 N Anp32e n/a
3 TRCN0000311770 CCAAATCTTACCTACCTCAAT pLKO_005 602 CDS 100% 4.950 6.930 N Anp32e n/a
4 TRCN0000077256 GTTGGAACTTAGTGACAATAT pLKO.1 544 CDS 100% 13.200 10.560 N Anp32e n/a
5 TRCN0000311767 GTTGGAACTTAGTGACAATAT pLKO_005 544 CDS 100% 13.200 10.560 N Anp32e n/a
6 TRCN0000077253 GCGATCACATTGTCTTTGTTT pLKO.1 1166 3UTR 100% 5.625 4.500 N Anp32e n/a
7 TRCN0000311769 GCGATCACATTGTCTTTGTTT pLKO_005 1166 3UTR 100% 5.625 4.500 N Anp32e n/a
8 TRCN0000312815 ACTTAATGAAAGACGAAATTC pLKO_005 975 CDS 100% 13.200 9.240 N Anp32e n/a
9 TRCN0000077936 CCTCTCATACTTAATGAAAGA pLKO.1 967 CDS 100% 4.950 3.465 N ANP32E n/a
10 TRCN0000333036 CCTCTCATACTTAATGAAAGA pLKO_005 967 CDS 100% 4.950 3.465 N ANP32E n/a
11 TRCN0000077255 CGATAATTGCTTGTGTGTCAA pLKO.1 412 CDS 100% 4.950 3.465 N Anp32e n/a
12 TRCN0000077254 CCTACCTCAATCTGAGTGGAA pLKO.1 612 CDS 100% 2.640 1.848 N Anp32e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023210.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.